437_81224, 437_81224 (genetic_marker) Fragaria iinumae

Marker Overview
Name437_81224
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
437_81224437_81224-22.902Fragaria iinumaemarker_locus
437_81224437_81224Fragaria iinumaemarker_locus


Sequence
>437_81224 ID=437_81224|Name=437_81224|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACCRACATAAGGCAAAAACCTGCAGAAAAGCAAAAATAAAATAAAATACA
ATACATCTAGAAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A22.9437_81224-22.902View
2Fragaria-Fii1N/A22.9437_81224View