437_79157, 437_79157 (genetic_marker) Fragaria iinumae

Marker Overview
Name437_79157
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
437_79157437_79157-22.902Fragaria iinumaemarker_locus
437_79157437_79157Fragaria iinumaemarker_locus


Sequence
>437_79157 ID=437_79157|Name=437_79157|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TACTCTTCCATGTGGATCTAGGTATTTTTGTCGCACTGTTCCGGTAGTCG
CATTCAATCCTTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A22.9437_79157-22.902View
2Fragaria-Fii1N/A22.9437_79157View