24_141007, 24_141007 (genetic_marker) Fragaria iinumae

Marker Overview
Name24_141007
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
24_14100724_141007-24.356Fragaria iinumaemarker_locus
24_14100724_141007Fragaria iinumaemarker_locus


Sequence
>24_141007 ID=24_141007|Name=24_141007|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GTTCTATACTTCAATATCTAAGTTGGTTATTCCTTGCTCGTCCCTCCCCA
TCCATCTTTTTTGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A24.3624_141007-24.356View
2Fragaria-Fii1N/A24.3624_141007View