TP8061, TP8061 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP8061
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP8061TP8061-24.356Fragaria iinumaemarker_locus
TP8061TP8061Fragaria iinumaemarker_locus


Sequence
>TP8061 ID=TP8061|Name=TP8061|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTAGTTGCGTTGTGGTGATGGGCTTATGGGATTGGGGTCTTCCCTG
CACACAAAAAAGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A24.36TP8061-24.356View
2Fragaria-Fii1N/A24.36TP8061View