TP6555, TP6555 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP6555
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP6555TP6555-25.332Fragaria iinumaemarker_locus
TP6555TP6555Fragaria iinumaemarker_locus


Sequence
>TP6555 ID=TP6555|Name=TP6555|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGCGGAGACGGAATTGTTCCACTGGAGCCGAGATCGGAAGAGCGTT
CAGCAGGAATGCCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A25.33TP6555-25.332View
2Fragaria-Fii1N/A25.33TP6555View