TP8738, TP8738 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP8738
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP8738TP8738-28.324Fragaria iinumaemarker_locus
TP8738TP8738Fragaria iinumaemarker_locus


Sequence
>TP8738 ID=TP8738|Name=TP8738|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTGTTGTGCATACGTAGTATTTGCCACAGCCGAGATCGGAAGAGCG
GTTCAGCAGGAATG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A28.32TP8738-28.324View
2Fragaria-Fii1N/A28.32TP8738View