TP3747, TP3747 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3747
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3747TP3747-31.365Fragaria iinumaemarker_locus
TP3747TP3747Fragaria iinumaemarker_locus


Sequence
>TP3747 ID=TP3747|Name=TP3747|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCCAAAAATAATATGCATAGAACTAATCACACCTGAAAGATATATT
ACTCATATTGCAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A31.37TP3747-31.365View
2Fragaria-Fii1N/A31.37TP3747View