24_587450, 24_587450 (genetic_marker) Fragaria iinumae

Marker Overview
Name24_587450
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
24_58745024_587450-31.365Fragaria iinumaemarker_locus
24_58745024_587450Fragaria iinumaemarker_locus


Sequence
>24_587450 ID=24_587450|Name=24_587450|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TATCATTTGACAGATAAAGTCTAAGCAACTCGTATTGCAGATGATCAGTG
ACATAGTCTTTATC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A31.3724_587450-31.365View
2Fragaria-Fii1N/A31.3724_587450View