24_587529, 24_587529 (genetic_marker) Fragaria iinumae

Marker Overview
Name24_587529
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
24_58752924_587529-31.365Fragaria iinumaemarker_locus
24_58752924_587529Fragaria iinumaemarker_locus


Sequence
>24_587529 ID=24_587529|Name=24_587529|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TATGGGTTTACAATGAGCATGTGACAAGTGCYCATTCTGCTTTCAAAGCT
TAAAATATCAAAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A31.3724_587529-31.365View
2Fragaria-Fii1N/A31.3724_587529View