24_767979, 24_767979 (genetic_marker) Fragaria iinumae

Marker Overview
Name24_767979
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
24_76797924_767979-32.903Fragaria iinumaemarker_locus
24_76797924_767979Fragaria iinumaemarker_locus


Sequence
>24_767979 ID=24_767979|Name=24_767979|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCCAGGGGTCGCAACTGGAGCACCAACAGGGRGAAATGTTGACGAGCTCG
TAACTGGTGCAACT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A32.924_767979-32.903View
2Fragaria-Fii1N/A32.924_767979View