156_201543, 156_201543 (genetic_marker) Fragaria iinumae

Marker Overview
Name156_201543
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
156_201543156_201543-34.523Fragaria iinumaemarker_locus
156_201543156_201543Fragaria iinumaemarker_locus


Sequence
>156_201543 ID=156_201543|Name=156_201543|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACCAGCTCAACGGCTCTGTCCCTGCAGAAATWGGTAACCTCTCCAACCTT
GAGTTCCTCTGGCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A34.52156_201543-34.523View
2Fragaria-Fii1N/A34.52156_201543View