156_201589, 156_201589 (genetic_marker) Fragaria iinumae

Marker Overview
Name156_201589
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
156_201589156_201589-34.523Fragaria iinumaemarker_locus
156_201589156_201589Fragaria iinumaemarker_locus


Sequence
>156_201589 ID=156_201589|Name=156_201589|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CCTTGAGTTCCTCTGGCTCTCTTGGCTTCCCRAAATGGCGCCATGGAAGC
TGCCTTTTGAATTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A34.52156_201589-34.523View
2Fragaria-Fii1N/A34.52156_201589View