26_49562, 26_49562 (genetic_marker) Fragaria iinumae

Marker Overview
Name26_49562
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
26_4956226_49562-34.523Fragaria iinumaemarker_locus
26_4956226_49562Fragaria iinumaemarker_locus


Sequence
>26_49562 ID=26_49562|Name=26_49562|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CCATGGCGGCTTTCCTTGCCCTAGCAGCAGCRGCCGCTGCCGCGGCTTTC
CTTGCCGCAGCAGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A34.5226_49562-34.523View
2Fragaria-Fii1N/A34.5226_49562View