26_49634, 26_49634 (genetic_marker) Fragaria iinumae

Marker Overview
Name26_49634
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
26_4963426_49634-36.195Fragaria iinumaemarker_locus
26_4963426_49634Fragaria iinumaemarker_locus


Sequence
>26_49634 ID=26_49634|Name=26_49634|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GCATCTTTGCAGCAGCAGCAGCAGCAAAAGCCTTGTTTTTCGACATAAAA
GACTTGTCGTAATC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A36.226_49634-36.195View
2Fragaria-Fii1N/A36.226_49634View