26_87196, 26_87196 (genetic_marker) Fragaria iinumae

Marker Overview
Name26_87196
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
26_8719626_87196-36.195Fragaria iinumaemarker_locus
26_8719626_87196Fragaria iinumaemarker_locus


Sequence
>26_87196 ID=26_87196|Name=26_87196|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTTTTGTAAACATGAACATCAATTGACAGAAGTAATATTAAGATTCATTC
CTGTACTAACCCCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A36.226_87196-36.195View
2Fragaria-Fii1N/A36.226_87196View