TP2513, TP2513 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2513
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2513TP2513-36.195Fragaria iinumaemarker_locus
TP2513TP2513Fragaria iinumaemarker_locus


Sequence
>TP2513 ID=TP2513|Name=TP2513|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGATTCGATGTAGTTGATTTTGTGTTCCACTCCGAGATCGGAAGAGC
GGTTCAGCAGGAAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A36.2TP2513-36.195View
2Fragaria-Fii1N/A36.2TP2513View