26_190726, 26_190726 (genetic_marker) Fragaria iinumae

Marker Overview
Name26_190726
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
26_19072626_190726-36.195Fragaria iinumaemarker_locus
26_19072626_190726Fragaria iinumaemarker_locus


Sequence
>26_190726 ID=26_190726|Name=26_190726|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAGGTAAACGTCTATGCAGAATGTGGTATTCGAAGGGCCGCCGTTCTCTC
AGCAAGCCAAGACT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A36.226_190726-36.195View
2Fragaria-Fii1N/A36.226_190726View