TP546, TP546 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP546
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP546TP546-37.912Fragaria iinumaemarker_locus
TP546TP546Fragaria iinumaemarker_locus


Sequence
>TP546 ID=TP546|Name=TP546|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAAGAGCAGGACCAACCTCTTCCACACCCCCAAATCACTTATTTTT
CCATATGACTTTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A37.91TP546-37.912View
2Fragaria-Fii1N/A37.91TP546View