TP2350, TP2350 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2350
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2350TP2350-39.419Fragaria iinumaemarker_locus
TP2350TP2350Fragaria iinumaemarker_locus


Sequence
>TP2350 ID=TP2350|Name=TP2350|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCTGCGTATTCATGGACAATATGTCCCCAGTCTGAAGCTGTGGAGT
TGATGGACTGGCTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A39.42TP2350-39.419View
2Fragaria-Fii1N/A39.42TP2350View