26_580720, 26_580720 (genetic_marker) Fragaria iinumae

Marker Overview
Name26_580720
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
26_58072026_580720-41.4Fragaria iinumaemarker_locus
26_58072026_580720Fragaria iinumaemarker_locus


Sequence
>26_580720 ID=26_580720|Name=26_580720|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGATCAAACCCCGGTAGCTGTGAAGGTTCTTCGCGCTGATGCAGTCGAGA
AAAAAGAGGAGTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A41.426_580720-41.4View
2Fragaria-Fii1N/A41.426_580720View