71_367836, 71_367836 (genetic_marker) Fragaria iinumae

Marker Overview
Name71_367836
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
71_36783671_367836-41.884Fragaria iinumaemarker_locus
71_36783671_367836Fragaria iinumaemarker_locus


Sequence
>71_367836 ID=71_367836|Name=71_367836|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATAAGATCTCCATGGCGCAATTGGTCCAGCCGATTGCGAATGGCGCTTTC
GTGCTGAGCATTGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A41.8871_367836-41.884View
2Fragaria-Fii1N/A41.8871_367836View