TP56, TP56 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP56
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP56TP56-42.367Fragaria iinumaemarker_locus
TP56TP56Fragaria iinumaemarker_locus


Sequence
>TP56 ID=TP56|Name=TP56|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAAAACTGTGAGTCATTATATGCAGGCAAAGCTTGCATGGAAGTGG
AATGGTCCAGAGTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A42.37TP56-42.367View
2Fragaria-Fii1N/A42.37TP56View