71_501478, 71_501478 (genetic_marker) Fragaria iinumae

Marker Overview
Name71_501478
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
71_50147871_501478-42.367Fragaria iinumaemarker_locus
71_50147871_501478Fragaria iinumaemarker_locus


Sequence
>71_501478 ID=71_501478|Name=71_501478|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAGAGAGCTCTTAACGCTAACCGTTGAAGCATGCAGACCTTATACATCCC
GGGATTCAGGTACA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A42.3771_501478-42.367View
2Fragaria-Fii1N/A42.3771_501478View