TP894, TP894 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP894
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP894TP894-42.367Fragaria iinumaemarker_locus
TP894TP894Fragaria iinumaemarker_locus


Sequence
>TP894 ID=TP894|Name=TP894|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAATTAATGTCTTAGGAGTTGGGAGGAACATTTCAAGTTCAACATT
TCATTCAATTCTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A42.37TP894-42.367View
2Fragaria-Fii1N/A42.37TP894View