596_44334, 596_44334 (genetic_marker) Fragaria iinumae

Marker Overview
Name596_44334
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
596_44334596_44334-42.85Fragaria iinumaemarker_locus
596_44334596_44334Fragaria iinumaemarker_locus


Sequence
>596_44334 ID=596_44334|Name=596_44334|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GAGTGTGAGCCATATATATCTAGCTCCCTCTGTGTCTTTTCCATTTGCCT
GTGAGTGTAAGCAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A42.85596_44334-42.85View
2Fragaria-Fii1N/A42.85596_44334View