TP3567, TP3567 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3567
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3567TP3567-42.85Fragaria iinumaemarker_locus
TP3567TP3567Fragaria iinumaemarker_locus


Sequence
>TP3567 ID=TP3567|Name=TP3567|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCATATGATGCTAGTTAGTACTTGGTCTGCTGCAAATATGTCACAA
ACAAGAAGATGAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii1N/A42.85TP3567-42.85View
2Fragaria-Fii1N/A42.85TP3567View