TP3967, TP3967 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3967
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3967TP3967-53.432Fragaria iinumaemarker_locus
TP3967TP3967Fragaria iinumaemarker_locus


Sequence
>TP3967 ID=TP3967|Name=TP3967|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCCATGTTCTTGACTTTACCCACTTGAGAGCTGCATAGCCATCTTC
ATAAGCACAAGGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A53.43TP3967-53.432View
2Fragaria-Fii3N/A53.43TP3967View