5_1583227, 5_1583227 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_1583227
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_15832275_1583227-53.432Fragaria iinumaemarker_locus
5_15832275_1583227Fragaria iinumaemarker_locus


Sequence
>5_1583227 ID=5_1583227|Name=5_1583227|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CAAACTGAGTCCCAAGGTAGATTAGACACTCYGAATCCGAGACATTGGAG
ATAGCTAGGGACCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A53.435_1583227-53.432View
2Fragaria-Fii3N/A53.435_1583227View