5_1578922, 5_1578922 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_1578922
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_15789225_1578922-53.432Fragaria iinumaemarker_locus
5_15789225_1578922Fragaria iinumaemarker_locus


Sequence
>5_1578922 ID=5_1578922|Name=5_1578922|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CCGGATAAAGGACCTCAATGTGAAAAATTTCACTCGAACACAGACAAGAA
CAATTTTATTGCCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A53.435_1578922-53.432View
2Fragaria-Fii3N/A53.435_1578922View