5_1268973, 5_1268973 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_1268973
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_12689735_1268973-54.398Fragaria iinumaemarker_locus
5_12689735_1268973Fragaria iinumaemarker_locus


Sequence
>5_1268973 ID=5_1268973|Name=5_1268973|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CTTCCGACGACATCGTTTTGGTCCTCTTCTTCTCTTTCTTCTTCAGCTCG
TTACCGGAGACCGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A54.45_1268973-54.398View
2Fragaria-Fii3N/A54.45_1268973View