5_1059429, 5_1059429 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_1059429
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_10594295_1059429-54.398Fragaria iinumaemarker_locus
5_10594295_1059429Fragaria iinumaemarker_locus


Sequence
>5_1059429 ID=5_1059429|Name=5_1059429|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTTTTTCTCTTTTTTCTTAATTTTCTTTTTGAGTTGTAGAGAGAGAAACA
GAGTTGAGATTTCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A54.45_1059429-54.398View
2Fragaria-Fii3N/A54.45_1059429View