5_1059346, 5_1059346 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_1059346
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_10593465_1059346-54.398Fragaria iinumaemarker_locus
5_10593465_1059346Fragaria iinumaemarker_locus


Sequence
>5_1059346 ID=5_1059346|Name=5_1059346|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GGGCTGCAGATACGAGAAAGAGAGAGAGAGAAAGCGAAGGGAGACAAATG
GAAATAAATAGGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A54.45_1059346-54.398View
2Fragaria-Fii3N/A54.45_1059346View