5_137828, 5_137828 (genetic_marker) Fragaria iinumae

Marker Overview
Name5_137828
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5_1378285_137828-55.365Fragaria iinumaemarker_locus
5_1378285_137828Fragaria iinumaemarker_locus


Sequence
>5_137828 ID=5_137828|Name=5_137828|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GAGGACGTCTTTGAAGCATTTCGTCGAACACYTTCAAGGCATCCTCAACA
TTACTCGCTAGATG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.375_137828-55.365View
2Fragaria-Fii3N/A55.375_137828View