TP9709, TP9709 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP9709
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP9709TP9709-55.365Fragaria iinumaemarker_locus
TP9709TP9709Fragaria iinumaemarker_locus


Sequence
>TP9709 ID=TP9709|Name=TP9709|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTTTCCTCGGCAAGTTCTATGTTGTTGTGTATCCTACAAGCTCCAA
GTAATGCACCGTAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.37TP9709-55.365View
2Fragaria-Fii3N/A55.37TP9709View