9_833054, 9_833054 (genetic_marker) Fragaria iinumae

Marker Overview
Name9_833054
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
9_8330549_833054-55.365Fragaria iinumaemarker_locus
9_8330549_833054Fragaria iinumaemarker_locus


Sequence
>9_833054 ID=9_833054|Name=9_833054|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AATCTTCCATCGATCCTGGTGGCAGTAATGTCTCAACTTTTACTATGGTA
CCAGGCACTAGCAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.379_833054-55.365View
2Fragaria-Fii3N/A55.379_833054View