127_476391, 127_476391 (genetic_marker) Fragaria iinumae

Marker Overview
Name127_476391
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
127_476391127_476391-55.365Fragaria iinumaemarker_locus
127_476391127_476391Fragaria iinumaemarker_locus


Sequence
>127_476391 ID=127_476391|Name=127_476391|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCTTGTGGGCTGCAGACTTACACACGCATATGTATGCATGTACGATCAGT
GTTTATATAATTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.37127_476391-55.365View
2Fragaria-Fii3N/A55.37127_476391View