TP8076, TP8076 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP8076
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP8076TP8076-55.365Fragaria iinumaemarker_locus
TP8076TP8076Fragaria iinumaemarker_locus


Sequence
>TP8076 ID=TP8076|Name=TP8076|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTATACGTCAAGTAATCTTCATTCTCATTTGAAACAATGGTAAAGT
TGTACCTCATCTTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.37TP8076-55.365View
2Fragaria-Fii3N/A55.37TP8076View