9_1492624, 9_1492624 (genetic_marker) Fragaria iinumae

Marker Overview
Name9_1492624
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
9_14926249_1492624-55.365Fragaria iinumaemarker_locus
9_14926249_1492624Fragaria iinumaemarker_locus


Sequence
>9_1492624 ID=9_1492624|Name=9_1492624|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CTAGAAGTGAGGACACTGTGTCAGCCCCAAAGAAGGTTAGGTATTCCCGG
AAGGCTAAGTAGTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.379_1492624-55.365View
2Fragaria-Fii3N/A55.379_1492624View