TP5929, TP5929 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP5929
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP5929TP5929-55.365Fragaria iinumaemarker_locus
TP5929TP5929Fragaria iinumaemarker_locus


Sequence
>TP5929 ID=TP5929|Name=TP5929|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGAAGTGTAAACAGGATAAACCTCGCCAATTCTGGTATTCAAGGTA
CGCTTCATGATCTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.37TP5929-55.365View
2Fragaria-Fii3N/A55.37TP5929View