310_136508, 310_136508 (genetic_marker) Fragaria iinumae

Marker Overview
Name310_136508
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
310_136508310_136508-55.365Fragaria iinumaemarker_locus
310_136508310_136508Fragaria iinumaemarker_locus


Sequence
>310_136508 ID=310_136508|Name=310_136508|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACCGGAAAAGTGATTCCTAGACAGATCAAGACAGATGAGTTTGGAGAGGG
AACTAATCTGAGGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.37310_136508-55.365View
2Fragaria-Fii3N/A55.37310_136508View