9_1005867, 9_1005867 (genetic_marker) Fragaria iinumae

Marker Overview
Name9_1005867
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
9_10058679_1005867-55.365Fragaria iinumaemarker_locus
9_10058679_1005867Fragaria iinumaemarker_locus


Sequence
>9_1005867 ID=9_1005867|Name=9_1005867|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TAACCGAATTTGAAACTGAGAACTTTCACACGTGTGTCGTCACATATGAC
TGATATGAGGCTGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A55.379_1005867-55.365View
2Fragaria-Fii3N/A55.379_1005867View