23_149629, 23_149629 (genetic_marker) Fragaria iinumae

Marker Overview
Name23_149629
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
23_14962923_149629-56.335Fragaria iinumaemarker_locus
23_14962923_149629Fragaria iinumaemarker_locus


Sequence
>23_149629 ID=23_149629|Name=23_149629|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CCAGCTCTTACCCAGTGTCTCCCCAATGTCCATTAAAGCTTGTACTACAG
GCAAATCCATCAGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A56.3423_149629-56.335View
2Fragaria-Fii3N/A56.3423_149629View