TP7011, TP7011 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP7011
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP7011TP7011-57.785Fragaria iinumaemarker_locus
TP7011TP7011Fragaria iinumaemarker_locus


Sequence
>TP7011 ID=TP7011|Name=TP7011|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGGGCAGCAGCAGCACACCGCCGCGCACTCCGCCGCTGCCCCGCCG
AGATCGGAAGAGCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A57.79TP7011-57.785View
2Fragaria-Fii3N/A57.79TP7011View