391_20567, 391_20567 (genetic_marker) Fragaria iinumae

Marker Overview
Name391_20567
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
391_20567391_20567-57.785Fragaria iinumaemarker_locus
391_20567391_20567Fragaria iinumaemarker_locus


Sequence
>391_20567 ID=391_20567|Name=391_20567|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TATATGAAGACTCCAATTACTTAAGATATGAAGCAGCAATGCACTATACA
AATATCTAGGGGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A57.79391_20567-57.785View
2Fragaria-Fii3N/A57.79391_20567View