346_65497, 346_65497 (genetic_marker) Fragaria iinumae

Marker Overview
Name346_65497
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
346_65497346_65497-57.785Fragaria iinumaemarker_locus
346_65497346_65497Fragaria iinumaemarker_locus


Sequence
>346_65497 ID=346_65497|Name=346_65497|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GGTGGTTGGGAGTTGGTGTATAGTATGTTGTCTGTGTTGTGATTGTTGTC
GATCATATGGACTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A57.79346_65497-57.785View
2Fragaria-Fii3N/A57.79346_65497View