241_204984, 241_204984 (genetic_marker) Fragaria iinumae

Marker Overview
Name241_204984
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
241_204984241_204984-60.219Fragaria iinumaemarker_locus
241_204984241_204984Fragaria iinumaemarker_locus


Sequence
>241_204984 ID=241_204984|Name=241_204984|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCAGTGGTGTGAGCATGGCGTTGAAGTTTAGTGTAAGAGGAAACAGGTAG
CCTAGACCAAGAAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22241_204984-60.219View
2Fragaria-Fii3N/A60.22241_204984View