241_287417, 241_287417 (genetic_marker) Fragaria iinumae

Marker Overview
Name241_287417
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
241_287417241_287417-60.219Fragaria iinumaemarker_locus
241_287417241_287417Fragaria iinumaemarker_locus


Sequence
>241_287417 ID=241_287417|Name=241_287417|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CGACCAGACCCCATTTAGCCTAAATCTTGTCMGATATTTTGGATTAGGAA
CTGATGCGGAAGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22241_287417-60.219View
2Fragaria-Fii3N/A60.22241_287417View