282_10889, 282_10889 (genetic_marker) Fragaria iinumae

Marker Overview
Name282_10889
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
282_10889282_10889-60.219Fragaria iinumaemarker_locus
282_10889282_10889Fragaria iinumaemarker_locus


Sequence
>282_10889 ID=282_10889|Name=282_10889|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CATGAACCCTAAGATGCGTTGCTTCATACAARCTTAGCATCCCCGGAACA
TCAGCAATTGAGCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22282_10889-60.219View
2Fragaria-Fii3N/A60.22282_10889View