TP6477, TP6477 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP6477
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP6477TP6477-60.219Fragaria iinumaemarker_locus
TP6477TP6477Fragaria iinumaemarker_locus


Sequence
>TP6477 ID=TP6477|Name=TP6477|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGCATTCATTTCCCTCTCTACTAAGGAGTTTAAGATAGAAGATTTA
GATTGTCAGATGCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22TP6477-60.219View
2Fragaria-Fii3N/A60.22TP6477View