378_47601, 378_47601 (genetic_marker) Fragaria iinumae

Marker Overview
Name378_47601
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
378_47601378_47601-60.219Fragaria iinumaemarker_locus
378_47601378_47601Fragaria iinumaemarker_locus


Sequence
>378_47601 ID=378_47601|Name=378_47601|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGACTCCTCGGATGATTTTTCCGATGACTCCTCGGATGATTTTTCCGATG
ACTCCCCAGATGGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22378_47601-60.219View
2Fragaria-Fii3N/A60.22378_47601View